| Aliases | hsa_circ_0001141 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr20:33001547-33037285:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000167098.11 | ||||
| Gene Name | SUN5 | Detection pipeline | . | ||||
| Sample Type | cd_19; K562; Helas3 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_95702 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr20:33001547-33037285 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T7;Diencephalon;Heart;Liver_N7;Parietal;Liver;Liver_N13;SH-SY5Y_D4_exp2;Occipital;Cerebellum;Temporal;Cortex;Hs68;Liver_N19;Liver_T21;Liver_N21 | ||||||||
| Method for Estimation | Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | cir-ITCH | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr20:33001547-33037285:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000167098.11 | ||||
| Gene Name | SUN5 | Detection pipeline | N/A | ||||
| Sample Type | Colorectal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCAGAGGCCAACACTGGAA | ||||||||
| Reverse Primer | TCCTTGAAGCTGACTACGCTGAG | ||||||||
| Aliases | Cir-ITCH | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr20:33001547-33037285:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000167098.11 | ||||
| Gene Name | SUN5 | Detection pipeline | N/A | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCAGAGGCCAACACTGGAA | ||||||||
| Reverse Primer | TCCTTGAAGCTGACTACGCTGAG | ||||||||
| Aliases | Cir-ITCH/hsa_circ_0001141 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr20:33001547-33037285:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000167098.11 | ||||
| Gene Name | SUN5 | Detection pipeline | N/A | ||||
| Sample Type | Bladder cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AGCAATGCAGCAGTTT | ||||||||
| Reverse Primer | TGTAGCCCATCAAGACA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |