Aliases hsa_circ_0024169 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:107916996-107925682:+
CircRNA type . Gene ID ENSG00000110660.14
Gene Name SLC35F2 Detection pipeline .
Sample Type K562; Bj; Ag04450; Nhek; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_3098 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:107916996-107925682
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type K562;Liver_T15;SH-SY5Y_D8_exp2;Liver;Liver_N7;Heart;Cerebellum;Liver_T6;Liver_N3;Parietal;Liver_N13;Liver_N6;Liver_N15;SK_N_SH;AG04450;SH-SY5Y_D0_exp1;Liver_N14;SH-SY5Y_D2_exp1;SH-SY5Y_D4_exp1;Cortex;Liver_N11;Liver_T8;Liver_T11;SH-SY5Y_D0_exp2;Forebrain;Diencephalon;Occipital;Liver_N12;Liver_T3;Stomach;Lung;PA1;BJ;Liver_N10;Liver_T14;Thyroid;SH-SY5Y_D4_exp2;Liver_T13;Liver_T12;Liver_N8;H1;Temporal;Liver_T7;Liver_T17;Liver_N20;Liver_T18;Liver_T21;Liver_N21;Liver_N19;Liver_T20;Liver_T22;Liver_N18;Liver_N17
Method for Estimation poly(A)-;Ribo-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000817 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:107916996-107925682:+
CircRNA type n/a Gene ID ENSG00000110660.14
Gene Name SLC35F2 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr11:107916996-107925682 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:107916996-107925682:n/a
CircRNA type n/a Gene ID ENSG00000166266.9
Gene Name CUL5 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ0817/hsa_circ_0024169 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:107916996-107925682:+
CircRNA type N/A Gene ID ENSG00000110660.14
Gene Name SLC35F2 Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACGTTATTTAGAAACAAGACGAGAATGT
Reverse Primer TCATCCCAAAGACAGACTGCAT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size