Aliases HSA_CIRCpedia_34474 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Cortex;Hs68
Method for Estimation RNaseR;Ribo-;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr20|47623910-47633636 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr20:47623910-47633636:n/a
CircRNA type circRNA Gene ID NA
Gene Name NA Detection pipeline CIRCexplorer2
Sample Type PDLSC osteogenis
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001207 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type ERR1161588
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001194 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type ERR1161589
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001180 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type ERR1161590
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001166 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type ERR1161591
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001355 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR837794
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000425 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR837795
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001300 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR837796
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000636 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR837797
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001569 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR837798
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009983 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR867813
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000853 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036961
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000784 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036962
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000842 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036963
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001114 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036964
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001519 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036965
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000745 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036966
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000707 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036967
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000901 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036968
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000893 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1036969
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000550 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643169
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000553 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643174
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000522 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643182
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000484 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643189
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000469 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643190
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000719 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643194
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000799 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643195
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000832 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643200
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000647 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643203
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000634 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1643204
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000656 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1706790
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001001 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1931812
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001164 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1931813
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001191 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1931814
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001011 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1931815
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000590 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1931817
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000756 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1931818
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007377 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1931819
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009732 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1363096
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008805 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1363098
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_010196 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1363099
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009197 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1363100
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001176 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1538596
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001122 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1538597
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000923 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1538598
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001016 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1600265
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000626 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1600266
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001528 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1600267
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001018 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR1600268
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_013306 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2082482
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001270 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2082493
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005509 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2082504
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006498 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2082508
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_011595 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131505
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001711 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131506
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001877 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131507
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001518 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131508
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000901 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131509
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001461 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131510
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001004 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131511
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000925 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131512
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001116 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131514
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001355 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131515
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001647 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131517
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001421 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131518
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001385 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131519
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009946 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131520
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005704 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131521
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001905 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131522
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001726 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131523
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001482 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131524
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005618 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131525
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001935 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131526
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001686 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131527
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001876 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131528
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005726 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131529
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001222 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131531
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001347 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131532
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001876 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131533
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001611 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131534
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005135 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131535
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009921 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131536
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005522 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131537
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005036 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131538
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001685 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131539
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005032 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131540
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008461 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131541
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008303 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131542
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007993 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131543
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006534 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131544
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006492 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131545
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007152 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2131546
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000678 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653982
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000716 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653983
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000732 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653984
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000791 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653986
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000742 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653987
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000505 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653988
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000656 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653990
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000672 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653991
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000449 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653993
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000519 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653994
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000565 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653995
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000783 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653996
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000479 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653997
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001014 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653998
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000593 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2653999
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000389 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654000
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000403 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654001
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000611 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654002
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000609 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654003
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001252 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654006
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000706 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654007
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000691 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654008
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000679 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654009
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001129 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654010
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001179 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654011
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000602 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654012
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000603 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654013
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001046 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654014
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001131 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654015
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000829 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654016
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000813 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654017
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000804 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654018
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000826 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654019
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000949 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654021
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001091 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654022
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001059 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654023
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000398 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654025
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000944 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654026
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000952 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654027
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000939 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654028
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000638 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654029
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000722 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654030
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000732 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654031
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000827 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654032
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000815 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654033
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001101 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654034
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001064 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654035
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000633 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654036
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000662 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654037
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000951 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654038
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000928 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2654039
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000714 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2924727
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000963 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2924728
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000894 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2924729
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000615 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2924732
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001397 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084933
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001423 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084934
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001105 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084937
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007426 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084938
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001204 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084939
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001233 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084940
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000983 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084943
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001221 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084946
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001356 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084948
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001069 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084949
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001227 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084950
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001254 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084953
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001256 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084954
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001393 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084955
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001142 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR3084959
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001011 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR954237
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001149 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2535260
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000506 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2537210
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000478 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2537212
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001313 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type . Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline .
Sample Type SRR2537232
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases test_circ_000930 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type 0 Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_000562 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type 0 Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline FindCirc
Sample Type CC
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_000904 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type 0 Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_000544 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type 0 Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_000733 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type 0 Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_000733 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type 0 Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases circRNA NCOA3 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr20:47623910-47633636:+
CircRNA type N/A Gene ID ENSG00000124151.18
Gene Name NCOA3 Detection pipeline N/A
Sample Type PDLSC osteogenis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GCAGTCATGGTCCCAGAAACG
Reverse Primer CCCGTCTCCGTTTTTCACCAC
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size