| Aliases | hsa_circ_0061274 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr21:16386664-16386787:- | ||||
| CircRNA type | . | Gene ID | ENSG00000180530.5 | ||||
| Gene Name | NRIP1 | Detection pipeline | . | ||||
| Sample Type | Nhek; K562; Helas3; Ag04450; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_35056 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr21:16386664-16386787 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Kidney;Liver;K562;PA1;NHEK;Liver_N10;Liver_N14;A549;Hs68;Liver_T22;Liver_N19;Liver_N20 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103109 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr21:16386664-16386787:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000180530.5 | ||||
| Gene Name | NRIP1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0061274 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr21:16386664-16386787:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000180530.5 | ||||
| Gene Name | NRIP1 | Detection pipeline | N/A | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CAGCCTTCTCAATTTTCTTTC | ||||||||
| Reverse Primer | AGTCTTCAGATTCCCTGTCCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |
| 184 | CCTTCAGTCAAGTGTGCATCTT | GGAGACAGACGGTGAGAATATT | 45.455 | 45.455 | 58.855 | 57.343 | 104 | 287 | 22 | 22 | |
| 184 | CCTTCAGTCAAGTGTGCATCTT | GGAGACAGACGGTGAGAATATT | 45.455 | 45.455 | 58.855 | 57.343 | 104 | 287 | 22 | 22 | |
| 184 | CCTTCAGTCAAGTGTGCATCTT | GGAGACAGACGGTGAGAATATT | 45.455 | 45.455 | 58.855 | 57.343 | 104 | 287 | 22 | 22 | |
| 184 | CCTTCAGTCAAGTGTGCATCTT | GGAGACAGACGGTGAGAATATT | 45.455 | 45.455 | 58.855 | 57.343 | 104 | 287 | 22 | 22 | |