Aliases hsa_circ_0004771 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:16386664-16415895:-
CircRNA type . Gene ID ENSG00000180530.5
Gene Name NRIP1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_35058 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:16386664-16415895
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type HepG2;Liver_T15;K562;Liver_N15;Heart;HUVEC;Liver_N13;Liver_N10;Liver_N6;Forebrain;Cerebellum;H9;GM12878;Liver_T14;PA1;Diencephalon;Liver_N7;Thyroid;H1;Liver_T3;Liver;Parietal;Temporal;NHEK;Liver_T8;Liver_T12;HeLa_S3;Kidney;Stomach;Lung;Occipital;Liver_N8;Liver_N11;Liver_N14;BJ;Liver_T7;AG04450;Liver_T10;Cortex;Liver_T13;A549;Liver_N12;Liver_T11;Liver_N3;Liver_T6;Hs68;Liver_T19;Liver_N18;Liver_N22;Liver_N21;Liver_T20;Liver_T21;Liver_T17;Liver_N19;Liver_N20;Liver_N17;Liver_T18;Liver_T22
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_003218 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:16386664-16415895:-
CircRNA type n/a Gene ID ENSG00000180530.5
Gene Name NRIP1 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_103110 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:16386664-16415895:-
CircRNA type exonic Gene ID ENSG00000180530.5
Gene Name NRIP1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_103110/hsa_circ_0004771 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:16386664-16415895:-
CircRNA type N/A Gene ID ENSG00000180530.5
Gene Name NRIP1 Detection pipeline N/A
Sample Type breast cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCGGATGACATCAGAGCTACT
Reverse Primer ACACTTCCGTCTGTCTCCAA
Pubmed 28484086
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size