| Aliases | hsa_circ_0003524 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:131829427-131840230:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152102.13 | ||||
| Gene Name | FAM168B | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_37878 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:131829427-131840230 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T10;Liver_N3;Occipital;H9;Liver_N13;SH-SY5Y_D0_exp1;Heart;SH-SY5Y_D2_exp1;Forebrain;Liver_T13;Thyroid;Liver_T11;BJ;Stomach;Cerebellum;Diencephalon;Liver_N14;Liver_N6;A549;SH-SY5Y_D4_exp1;PA1;AG04450;K562;H1;Liver_N7;Liver;Liver_T12;Temporal;Parietal;Liver_N12;NHEK;Liver_T6;HeLa_S3;HUVEC;Liver_T3;Cortex;HepG2;Liver_T14;Liver_N10;Liver_N8;Hs68;Liver_T22;Liver_N17;Liver_T19;Liver_T21;Liver_N22;Liver_N20;Liver_N19;Liver_T17;Liver_N18 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_003524 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:131829427-131840230:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000152102.13 | ||||
| Gene Name | FAM168B | Detection pipeline | N/A | ||||
| Sample Type | Rheumatoid Arthritis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCCTGGAGCGAATCCTACCTT | ||||||||
| Reverse Primer | TTTGGCATTTGCATAGGGAAC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |