Aliases hsa_circ_0001187 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:37619814-37620866:+
CircRNA type . Gene ID ENSG00000157542.10
Gene Name KCNJ6 Detection pipeline .
Sample Type cd_19; cd_34; neutr; Nhek; K562; Huvec; Hmec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_35373 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:37619814-37620866
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type HUVEC;Kidney;Occipital;Liver_T3;H9;NHEK;Heart;Liver_N11;Cerebellum;Liver_T12;PA1;Temporal;Liver_N7;Stomach;GM12878;Liver_T7;Liver_N12;SH-SY5Y_D4_exp2;SH-SY5Y_D4_exp1;Liver_N13;Liver_T14;Liver_N3;H1;Liver_N6;Liver_T13;HepG2;Parietal;SH-SY5Y_D0_exp1;Liver_N14;Liver_T11;Cortex;Diencephalon;K562;Liver_T6;Liver_N8;HeLa_S3;Liver_T15;Liver_N15;Liver_N10;Forebrain;Thyroid;Liver_T8;SH-SY5Y_D2_exp1;Liver;BJ;Lung;A549;AG04450;Hs68;Liver_N17;Liver_T17;Liver_T20;Liver_N18;Liver_N20;Liver_T21;Liver_T18;Liver_T19;Liver_T22;Liver_N22;Liver_N21;Liver_N19
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_008785 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:37619814-37620866:+
CircRNA type n/a Gene ID ENSG00000157542.10
Gene Name KCNJ6 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_103124 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:37619814-37620866:+
CircRNA type exonic Gene ID ENSG00000157542.10
Gene Name KCNJ6 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0001187 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:37619814-37620866:n/a
CircRNA type n/a Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 28080204
Aliases hsa_circ_0001187 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr21:37619814-37620866:+
CircRNA type N/A Gene ID ENSG00000157542.10
Gene Name KCNJ6 Detection pipeline N/A
Sample Type Cervical carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CAAAAGAGACCTGTCGATCTCC
Reverse Primer TGGCTTGTTCCAAAAGACAAA
Pubmed 28080204
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size