Aliases hsa_circ_0001073 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:148653869-148657467:+
CircRNA type . Gene ID ENSG00000135999.11
Gene Name EPC2 Detection pipeline .
Sample Type HEK293; cd_19; cd_34; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_38060 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:148653869-148657467
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T3;Thyroid;K562;Stomach;NHEK;BJ;Liver_N10;Liver_T13;Cortex;SH-SY5Y_D0_exp2;Liver_N3;Liver_T12;Lung;Liver_N15;Liver_N8;HeLa_S3;HepG2;PA1;GM12878;Liver_N7;Liver_T7;Liver_T8;HUVEC;Occipital;Liver_N12;Liver_T15;Liver_T10;SH-SY5Y_D8_exp2;Liver_N11;Liver_N13;Liver_N14;SH-SY5Y_D4_exp1;Kidney;Liver;H9;SH-SY5Y_D4_exp2;Liver_T6;Heart;AG04450;Diencephalon;H1;Temporal;Cerebellum;SH-SY5Y_D2_exp1;Liver_T11;SH-SY5Y_D0_exp1;Liver_T14;Forebrain;Parietal;A549;Liver_N6;Hs68;Liver_N18;Liver_T19;Liver_T18;Liver_N17;Liver_T22;Liver_T20;Liver_N20;Liver_T17;Liver_N21;Liver_N19;Liver_T21;Liver_N22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_005102 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:148653869-148657467:+
CircRNA type n/a Gene ID ENSG00000135999.11
Gene Name EPC2 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr2:148653869-148657467 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:148653869-148657467:n/a
CircRNA type n/a Gene ID ENSG00000223911.1;ENSG00000121989.10
Gene Name AC009480.3;ACVR2A Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_102830 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:148653869-148657467:+
CircRNA type exonic Gene ID ENSG00000135999.11
Gene Name EPC2 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circRNA_0001073 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:148653869-148657467:+
CircRNA type N/A Gene ID ENSG00000135999.11
Gene Name EPC2 Detection pipeline N/A
Sample Type Acne
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CACAAGATGGCCTACCCTCC
Reverse Primer CCATAACACGGTTCAACACCA
Pubmed 29573483
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size