Aliases circRNA7536 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:160169212-160196420:-
CircRNA type circRNA Gene ID ENSG00000115221.11
Gene Name ITGB6 Detection pipeline find_circ
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circRNA7536 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:160169212-160196420:-
CircRNA type N/A Gene ID ENSG00000115221.11
Gene Name ITGB6 Detection pipeline N/A
Sample Type Esophageal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGTAACCCAAGAACAAGTTCA
Reverse Primer GGTATCACACCTTTCGCCA
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
105 CAACCCAGCTAATCTTCATGTGT agtccatccattttgctgca 43.478 45 58.988 58.073 168 272 23 20
118 GAGAACAACCCAGCTAATCTTCA tgtcctccagtccatccatt 43.478 50 58.42 58.029 163 280 23 20
147 TCTAATGAGAACAACCCAGCTAA ctggcttatttcacccagga 39.13 50 57.245 57.193 157 303 23 20
117 ATGAGAACAACCCAGCTAATCT cctccagtccatccattttgc 40.909 52.381 57.148 59.247 161 277 22 21
105 CAACCCAGCTAATCTTCATGTGT agtccatccattttgctgca 43.478 45 58.988 58.073 168 272 23 20
118 GAGAACAACCCAGCTAATCTTCA tgtcctccagtccatccatt 43.478 50 58.42 58.029 163 280 23 20
117 ATGAGAACAACCCAGCTAATCT cctccagtccatccattttgc 40.909 52.381 57.148 59.247 161 277 22 21
147 TCTAATGAGAACAACCCAGCTAA ctggcttatttcacccagga 39.13 50 57.245 57.193 157 303 23 20
105 CAACCCAGCTAATCTTCATGTGT agtccatccattttgctgca 43.478 45 58.988 58.073 168 272 23 20
117 ATGAGAACAACCCAGCTAATCT cctccagtccatccattttgc 40.909 52.381 57.148 59.247 161 277 22 21
118 GAGAACAACCCAGCTAATCTTCA tgtcctccagtccatccatt 43.478 50 58.42 58.029 163 280 23 20
147 TCTAATGAGAACAACCCAGCTAA ctggcttatttcacccagga 39.13 50 57.245 57.193 157 303 23 20