Aliases circRNA7537 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:160196216-160199258:-
CircRNA type circRNA Gene ID ENSG00000115221.11
Gene Name ITGB6 Detection pipeline find_circ
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 29218114
Aliases circRNA7537 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:160196216-160199258:-
CircRNA type N/A Gene ID ENSG00000115221.11
Gene Name ITGB6 Detection pipeline N/A
Sample Type Esophageal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TCAGATTGCGCCTCAA
Reverse Primer GGCAGTCTTCACAGGTTTC
Pubmed 29218114
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
143 tggatggactggaggacatt tcccagaactaaccaccaatct 50 45.455 58.029 58.743 67 209 20 22
175 gcaaaatggatggactggagg ccggacacagtggctcat 52.381 61.111 59.247 59.335 61 235 21 18
167 tgcagcaaaatggatggact gctcatgcctgtaatcccag 45 55 58.073 58.398 57 223 20 20
113 agattggtggttagttctggga tgggattgccttcttgatttct 45.455 40.909 58.743 57.948 188 300 22 22
174 ggatggactggaggacattatc ctgaggccggacacagtg 50 66.667 57.721 60.048 68 241 22 18
115 tggtggttagttctgggattaca tgtaaatgggattgccttcttga 43.478 39.13 59.089 58.328 192 306 23 23
167 tgcagcaaaatggatggact gctcatgcctgtaatcccag 45 55 58.073 58.398 57 223 20 20
143 tggatggactggaggacatt tcccagaactaaccaccaatct 50 45.455 58.029 58.743 67 209 20 22
175 gcaaaatggatggactggagg ccggacacagtggctcat 52.381 61.111 59.247 59.335 61 235 21 18
113 agattggtggttagttctggga tgggattgccttcttgatttct 45.455 40.909 58.743 57.948 188 300 22 22
174 ggatggactggaggacattatc ctgaggccggacacagtg 50 66.667 57.721 60.048 68 241 22 18
115 tggtggttagttctgggattaca tgtaaatgggattgccttcttga 43.478 39.13 59.089 58.328 192 306 23 23
167 tgcagcaaaatggatggact gctcatgcctgtaatcccag 45 55 58.073 58.398 57 223 20 20
143 tggatggactggaggacatt tcccagaactaaccaccaatct 50 45.455 58.029 58.743 67 209 20 22
113 agattggtggttagttctggga tgggattgccttcttgatttct 45.455 40.909 58.743 57.948 188 300 22 22
175 gcaaaatggatggactggagg ccggacacagtggctcat 52.381 61.111 59.247 59.335 61 235 21 18
174 ggatggactggaggacattatc ctgaggccggacacagtg 50 66.667 57.721 60.048 68 241 22 18
115 tggtggttagttctgggattaca tgtaaatgggattgccttcttga 43.478 39.13 59.089 58.328 192 306 23 23