| Aliases | chr2:174987907|175006728 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:174987907-175006728:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000138430.11 | ||||
| Gene Name | OLA1 | Detection pipeline | n/a | ||||
| Sample Type | Breast cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0057129 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:174987907-175006728:- | ||||
| CircRNA type | . | Gene ID | ENSG00000138430.11 | ||||
| Gene Name | OLA1 | Detection pipeline | . | ||||
| Sample Type | K562; Helas3 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_38673 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:174987907-175006728 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | K562;Liver_T13;Liver_T14;Liver_T8;Cortex;Liver_N11;Liver_T12;Liver_T10;Heart;Liver_N13;Cerebellum;Liver_T15;SH-SY5Y_D0_exp1;Liver_T7;Stomach;Liver_N14;Liver_N3;HeLa_S3;Lung;Occipital;SH-SY5Y_D0_exp2;Kidney;Parietal;Forebrain;Liver_T3;Temporal;Liver;Liver_T11;Diencephalon;Liver_T22;Liver_T21;Liver_T19;Liver_T18;Liver_N20;Liver_N17 | ||||||||
| Method for Estimation | poly(A)-;Ribo- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circOLA | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:174987907-175006728:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000138430.11 | ||||
| Gene Name | OLA1 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GAAGGTGGTGTGCTTGGATAGTT | ||||||||
| Reverse Primer | TTTTATCTCCTCCTCTCACAGCC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |