Aliases hsa_circ_0002271 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:20974569-20990158:-
CircRNA type . Gene ID ENSG00000118961.10
Gene Name C2orf43 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Huvec; Hepg2; Helas3; H1hesc; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_39482 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:20974569-20990158
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver;Liver_T10;Liver_T8;PA1;HUVEC;H1;Liver_T6;Liver_N13;SH-SY5Y_D2_exp1;HeLa_S3;Cortex;Liver_N8;BJ;Forebrain;HepG2;Occipital;AG04450;Liver_N12;Temporal;A549;Diencephalon;Liver_T12;Liver_N3;K562;Hs68;Liver_N18;Liver_N17
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_002271/hsa_circ_0002271 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:20974569-20990158:-
CircRNA type N/A Gene ID ENSG00000118961.10
Gene Name C2orf43 Detection pipeline N/A
Sample Type Thoracic Aortic Dissection
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CAAACTGGAAAGCGTCTGTTTG
Reverse Primer GCTCATTGGCCATTCAATAGG
Pubmed 29137225
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size