Aliases circRNA7674 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:215373322-215391814:-
CircRNA type circRNA Gene ID ENSG00000115414.18
Gene Name FN1 Detection pipeline find_circ
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circRNA7674 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:215373322-215391814:-
CircRNA type N/A Gene ID ENSG00000115414.18
Gene Name FN1 Detection pipeline N/A
Sample Type Esophageal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AAGAATAATCAGAAGAGCGAGC
Reverse Primer GGAGCCCAGGTGACACG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size