| Aliases | hsa_circ_0058106 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:216246934-216248907:- | ||||
| CircRNA type | . | Gene ID | ENSG00000115414.14 | ||||
| Gene Name | FN1 | Detection pipeline | . | ||||
| Sample Type | Ag04450 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_93489 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:216246934-216248907 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N13;AG04450;Hs68;Liver_T20 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0058106 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:216246934-216248907:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000115414.14 | ||||
| Gene Name | FN1 | Detection pipeline | N/A | ||||
| Sample Type | Hypopharyngeal Squamous Cell Carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CTGCAGGTCCAGATCAAACA | ||||||||
| Reverse Primer | GTTTAAGGCCGCTGATGGTA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |