Aliases hsa_circ_0004872 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr22:22153300-22162135:-
CircRNA type . Gene ID ENSG00000100030.10
Gene Name MAPK1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_36056 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr22:22153300-22162135
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type AG04450;Stomach;Liver_T13;SH-SY5Y_D0_exp2;K562;Liver_T6;HUVEC;Liver_N14;Cortex;Occipital;Thyroid;PA1;A549;Diencephalon;Liver_T10;Liver_T8;HepG2;Liver;Liver_N12;Liver_T14;Temporal;Liver_N11;Liver_N7;Lung;Liver_T11;Cerebellum;H9;Liver_N13;Liver_N6;Forebrain;GM12878;Heart;Liver_T12;Liver_N3;Liver_N10;HeLa_S3;Liver_T3;H1;NHEK;Kidney;BJ;Parietal;Hs68;Liver_N21;Liver_T17;Liver_T22;Liver_T20;Liver_T21;Liver_N17;Liver_N19;Liver_T18;Liver_T19;Liver_N22;Liver_N20
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circ_0004872 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr22:22153300-22162135:-
CircRNA type N/A Gene ID ENSG00000100030.10
Gene Name MAPK1 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGCAGATCCAGACCATGATCACA
Reverse Primer TTCTCATGTCTGAAGCGCAGT
Pubmed 28236760
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size