| Aliases | hsa_circ_0001212 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:24056373-24057381:- | ||||
| CircRNA type | . | Gene ID | ENSG00000099991.17 | ||||
| Gene Name | CABIN1 | Detection pipeline | . | ||||
| Sample Type | cd_34; Hs68_RNase; Hs68_control; Gm12878; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_36094 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:24056373-24057381 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | NHEK;HepG2;Diencephalon;Liver_T11;Cortex;Liver_T15;Parietal;Occipital;Liver_T8;Liver_N15;Temporal;Cerebellum;GM12878;H1;SH-SY5Y_D0_exp1;AG04450;HeLa_S3;Liver_N11;BJ;A549;Hs68;Liver_T19;Liver_N18;Liver_T17;Liver_N20 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_001886 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:24056373-24057381:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000099991.17 | ||||
| Gene Name | CABIN1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0001212 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:24056373-24057381:n/a | ||||
| CircRNA type | n/a | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | n/a | ||||
| Sample Type | cervical carcinoma | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0001212 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:24056373-24057381:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000099991.17 | ||||
| Gene Name | CABIN1 | Detection pipeline | N/A | ||||
| Sample Type | Cervical carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GTGAAGCGAGACAGTGGTGA | ||||||||
| Reverse Primer | ACCACAACCAGCTGACAAAA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |