| Aliases | hsa_circ_0063179 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:37328806-37330036:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000100368.9 | ||||
| Gene Name | CSF2RB | Detection pipeline | . | ||||
| Sample Type | Gm12878 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_36596 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:37328806-37330036 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver;Liver_T13;NHEK;HUVEC;Liver_T12;Liver_N15;Liver_N13;Liver_N12;Liver_T7;Liver_T14;GM12878;Thyroid;Liver_N10;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0063179 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:37328806-37330036:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000100368.9 | ||||
| Gene Name | CSF2RB | Detection pipeline | N/A | ||||
| Sample Type | Pulmonary tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GATCTGGAGCGAGTGGAGTG | ||||||||
| Reverse Primer | TGTGTTCGTATCGCATTTTCA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |