| Aliases | hsa_circ_0003391 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:122646926-122647918:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000154127.5 | ||||
| Gene Name | UBASH3B | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_3560 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:122646926-122647918 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Parietal;Diencephalon;Liver_N13;AG04450;PA1;Forebrain;Liver_N7;GM12878;HepG2;Cortex;Lung;H9;Liver_N11;SH-SY5Y_D0_exp2;Liver_N3;NHEK;BJ;Liver_T14;HUVEC;Liver_T8;A549;Liver_T7;Temporal;Heart;Cerebellum;Liver_N15;HeLa_S3;Occipital;Hs68;Liver_N17;Liver_T21;Liver_N20;Liver_T19;Liver_T18;Liver_N21;Liver_N19 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0003391 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:122646926-122647918:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000154127.5 | ||||
| Gene Name | UBASH3B | Detection pipeline | N/A | ||||
| Sample Type | Postmenopausal Osteoporosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CACAACATCTTCCCCCACAT | ||||||||
| Reverse Primer | GATGCCAAGGCTTTTTGTCA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |