| Aliases | hsa_circ_0063781 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:46594238-46594488:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000186951.12 | ||||
| Gene Name | PPARA | Detection pipeline | . | ||||
| Sample Type | Nhek; Helas3; Gm12878; Bj; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_37051 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:46594238-46594488 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N15;Parietal;AG04450;HeLa_S3;GM12878;Liver_T7;Liver_T11;Heart;Temporal;HepG2;Liver_N7;Liver_N11;Cortex;NHEK;Liver_N14;Liver;BJ;Liver_N6;Liver_N12;Hs68;Liver_N21;Liver_N18;Liver_N17;Liver_T21;Liver_N19;Liver_N22 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0063781 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr22:46594238-46594488:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000186951.12 | ||||
| Gene Name | PPARA | Detection pipeline | N/A | ||||
| Sample Type | Osteoarthritis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GAAGCTGTCCTGGCTCAGAT | ||||||||
| Reverse Primer | GACCAGATGGTGCTGGTTGT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |