Aliases hsa_circ_0007385 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:32142994-32157204:-
CircRNA type . Gene ID ENSG00000021574.12
Gene Name SPAST Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hsmm; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_40737 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:32142994-32157204
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T7;Cortex;Liver_T10;Forebrain;Lung;Liver;Liver_N7;Liver_N10;Liver_T11;Liver_N11;Thyroid;AG04450;SH-SY5Y_D4_exp1;PA1;Liver_N6;H1;SH-SY5Y_D8_exp2;Heart;H9;Liver_N13;Liver_T8;GM12878;Diencephalon;SH-SY5Y_D0_exp1;SH-SY5Y_D0_exp2;K562;Liver_N15;SH-SY5Y_D4_exp2;NHEK;Liver_T3;Liver_N3;Liver_T6;HepG2;Liver_N8;HeLa_S3;Liver_T14;Liver_T15;Temporal;Stomach;BJ;Occipital;Cerebellum;Liver_N12;HUVEC;SH-SY5Y_D2_exp1;Liver_T12;A549;Parietal;Hs68;Liver_N17;Liver_N20;Liver_T18;Liver_T17;Liver_N19;Liver_T21;Liver_T20;Liver_N21;Liver_T19;Liver_T22;Liver_N22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_102658 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:32142994-32157204:-
CircRNA type exonic Gene ID ENSG00000021574.12
Gene Name SPAST Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0007385 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:32142994-32157204:-
CircRNA type N/A Gene ID ENSG00000021574.12
Gene Name SPAST Detection pipeline N/A
Sample Type Non-Small cell Lung Cancer tumorigenesis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CGTGACCCAGAAGTGCGTTCACA
Reverse Primer TGGGGGTGTATCAGTCTTTGGTT
Pubmed 29372377
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size