Aliases hsa_circ_0007386 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:36668400-36669878:+
CircRNA type . Gene ID ENSG00000150938.5
Gene Name CRIM1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hsmm; Hmec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhlf; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_41049 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:36668400-36669878
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N13;PA1;HUVEC;K562;H1;Liver_T11;NHEK;Liver_T12;Cortex;Diencephalon;AG04450;Thyroid;Kidney;Liver_N12;Cerebellum;Liver_T8;Temporal;Stomach;Parietal;BJ;Liver_N8;Liver_N14;Liver_N11;Liver_T10;A549;Forebrain;GM12878;Liver_T13;Lung;HeLa_S3;Liver_T14;Liver_N3;Occipital;H9;Liver;HepG2;Hs68;Liver_N19;Liver_T17;Liver_T22;Liver_N22;Liver_N18;Liver_T19;Liver_T20;Liver_N20;Liver_N17
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_005914 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:36668400-36669878:+
CircRNA type n/a Gene ID ENSG00000150938.5
Gene Name CRIM1 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_102683 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:36668400-36669878:+
CircRNA type exonic Gene ID ENSG00000150938.5
Gene Name CRIM1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0007386 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:36668400-36669878:n/a
CircRNA type n/a Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 28080204
Aliases hsa_circ_0007386 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:36668400-36669878:+
CircRNA type N/A Gene ID ENSG00000150938.5
Gene Name CRIM1 Detection pipeline N/A
Sample Type Cervical carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCCGGACAGCTATGAAACTC
Reverse Primer AGGAGCATAACCCTCGATCA
Pubmed 28080204
Aliases hsa_circRNA_102683/hsa_circ_0007386 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr2:36668400-36669878:+
CircRNA type N/A Gene ID ENSG00000150938.5
Gene Name CRIM1 Detection pipeline N/A
Sample Type Thoracic Aortic Dissection
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CAGGACAACGTGGAGAGAACTG
Reverse Primer AGACTAACTGCAGATGGTTGCTGTAC
Pubmed 29137225
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size