| Aliases | hsa_circ_00054211 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:39559057-39564722:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000011566.10 | ||||
| Gene Name | MAP4K3 | Detection pipeline | n/a | ||||
| Sample Type | multiple system atrophy | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0054211 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:39559057-39564722:- | ||||
| CircRNA type | . | Gene ID | ENSG00000011566.10 | ||||
| Gene Name | MAP4K3 | Detection pipeline | . | ||||
| Sample Type | K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_41258 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:39559057-39564722 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | PA1;SH-SY5Y_D0_exp1;A549;Kidney;SH-SY5Y_D0_exp2;Heart;Liver_N8;AG04450;Liver_N11;Liver_T11;Liver_T12;H9;Lung;Forebrain;SH-SY5Y_D4_exp1;NHEK;Liver_T3;Liver_N7;K562;Liver_N14;HeLa_S3;Liver_T15;Occipital;Liver_T10;HepG2;Cortex;Diencephalon;Liver_N10;Liver_N12;Liver_N13;Liver_T7;Temporal;H1;Liver_T6;Liver_N6;Parietal;Cerebellum;Liver_N15;SH-SY5Y_D2_exp1;BJ;Thyroid;Liver;Liver_T14;SH-SY5Y_D8_exp2;Liver_T8;Hs68;Liver_T19;Liver_N19;Liver_N22;Liver_N18;Liver_N20;Liver_T21;Liver_N17;Liver_T18;Liver_T22;Liver_T20;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_102699 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:39559057-39564722:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000011566.10 | ||||
| Gene Name | MAP4K3 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | MAP4K3/hsa_circ_0054211 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:39559057-39564722:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000011566.10 | ||||
| Gene Name | MAP4K3 | Detection pipeline | N/A | ||||
| Sample Type | Multiple system atrophy (MSA) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCAAATTGCATATGTTAGCAGAGA | ||||||||
| Reverse Primer | GGTCCAGTTACAATATGGTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |