| Aliases | hsa_circ_0054345 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:44139570-44145537:- | ||||
| CircRNA type | . | Gene ID | ENSG00000138095.14 | ||||
| Gene Name | LRPPRC | Detection pipeline | . | ||||
| Sample Type | K562 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_41398 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:44139570-44145537 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | PA1;SH-SY5Y_D4_exp1;Liver_N14;Liver_T12;Occipital;Liver_T10;K562;Diencephalon;Temporal;Liver_T14;Liver;Cortex;Liver_N3;SH-SY5Y_D4_exp2;GM12878;Liver_N8;SH-SY5Y_D0_exp2;Liver_T13;Parietal;H9;Cerebellum;Liver_T6;SH-SY5Y_D2_exp1;Hs68;Liver_T19;Liver_N17;Liver_T21;Liver_N20;Liver_N18;Liver_N21;Liver_T17;Liver_N19 | ||||||||
| Method for Estimation | RNaseR;Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0054345 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:44139570-44145537:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000138095.14 | ||||
| Gene Name | LRPPRC | Detection pipeline | N/A | ||||
| Sample Type | Irradiated Hepatic Stellate Cell (HSC) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATGCTGAAACCTACAGCAATCTCAT | ||||||||
| Reverse Primer | GCATCAGCTCTTTGCCAGTCA | ||||||||
| Aliases | hsa_circ_0054345 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:44139570-44145537:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000138095.14 | ||||
| Gene Name | LRPPRC | Detection pipeline | N/A | ||||
| Sample Type | Irradiated Hepatic Stellate Cell (HSC) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATGCTGAAACCTACAGCAATCTCAT | ||||||||
| Reverse Primer | GCATCAGCTCTTTGCCAGTCA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |