| Aliases | hsa_circ_0055377 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:80772106-80783018:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000066032.14 | ||||
| Gene Name | CTNNA2 | Detection pipeline | . | ||||
| Sample Type | Gm12878 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_42389 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:80772106-80783018 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Parietal;Temporal;GM12878;Diencephalon | ||||||||
| Method for Estimation | Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_102771 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:80772106-80783018:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000066032.14 | ||||
| Gene Name | CTNNA2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_102771/hsa_circ_0055377 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:80772106-80783018:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000066032.14 | ||||
| Gene Name | CTNNA2 | Detection pipeline | N/A | ||||
| Sample Type | Thoracic Aortic Dissection | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CGAACTAATTTCACCCCTTCTTCA | ||||||||
| Reverse Primer | ACATCATCAATGCTGAGATGGAG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |