| Aliases | hsa_circ_0002362 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:9458652-9468040:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000119203.13 | ||||
| Gene Name | CPSF3 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_42597 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:9458652-9468040 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Heart;Occipital;SH-SY5Y_D0_exp2;Liver_T8;SH-SY5Y_D4_exp1;SH-SY5Y_D8_exp2;Diencephalon;Liver_N8;PA1;Cortex;Temporal;SH-SY5Y_D0_exp1;Liver_N13;Parietal;Liver_N11;Liver_T14;Hs68;Liver_T22;Liver_T19 | ||||||||
| Method for Estimation | Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0002362 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr2:9458652-9468040:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000119203.13 | ||||
| Gene Name | CPSF3 | Detection pipeline | N/A | ||||
| Sample Type | Pulmonary tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCTGCTGAAGGTCAACGAAA | ||||||||
| Reverse Primer | GCAAACTGTCCAAAGGGAAG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |