Aliases hsa_circ_0008797 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:119582265-119624699:-
CircRNA type . Gene ID ENSG00000144837.8
Gene Name PLA1A Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Hsmm; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_43090 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:119582265-119624699
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Heart;K562;Liver_T14;Liver_T6;Parietal;Temporal;Liver_T15;H9;Liver_N7;PA1;Liver_N15;HepG2;Liver_T11;Liver_T12;Occipital;H1;Forebrain;Thyroid;Liver;Liver_T13;Liver_T8;Liver_N14;Liver_N3;Cerebellum;GM12878;BJ;Diencephalon;A549;Kidney;SH-SY5Y_D4_exp2;SH-SY5Y_D2_exp1;SH-SY5Y_D0_exp2;Liver_N12;NHEK;Stomach;AG04450;Liver_T3;Liver_N13;HeLa_S3;SH-SY5Y_D4_exp1;Cortex;Liver_N11;Lung;Liver_T10;Liver_T7;Hs68;Liver_T20;Liver_T22;Liver_N18;Liver_T21;Liver_T19;Liver_N20;Liver_N22;Liver_N19;Liver_T18;Liver_N17;Liver_T17;Liver_N21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_003599 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:119582265-119624699:-
CircRNA type n/a Gene ID ENSG00000144837.8
Gene Name PLA1A Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_103444 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:119582265-119624699:-
CircRNA type exonic Gene ID ENSG00000144837.8
Gene Name PLA1A Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0008797 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:119582265-119624699:-
CircRNA type N/A Gene ID ENSG00000144837.8
Gene Name PLA1A Detection pipeline N/A
Sample Type Pulmonary tuberculosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGGGCAGGAGAATGTGACAA
Reverse Primer TCCCCTGGAAATATTGGTTG
Pubmed 29248507
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size