| Aliases | hsa_circ_0067175 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:127393233-127393443:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000114626.13 | ||||
| Gene Name | ABTB1 | Detection pipeline | . | ||||
| Sample Type | Huvec; Bj; Ag04450; Nhlf | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_43437 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:127393233-127393443 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | PA1;HUVEC;Lung;Thyroid;Liver_N13;AG04450;Liver_N11;BJ;Liver;Hs68;Liver_N20;Liver_N17 | ||||||||
| Method for Estimation | RNaseR;poly(A)-;Ribo- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000584 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:127393233-127393443:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000114626.13 | ||||
| Gene Name | ABTB1 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103458/hsa_circ_0067175 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:127393233-127393443:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000114626.13 | ||||
| Gene Name | ABTB1 | Detection pipeline | N/A | ||||
| Sample Type | Thoracic Aortic Dissection | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CACTTGTCCCGCACATTCAC | ||||||||
| Reverse Primer | GTGTGGGCACGAGGAGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |