| Aliases | hsa_circ_0067531 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:138413627-138417937:- | ||||
| CircRNA type | . | Gene ID | ENSG00000051382.4 | ||||
| Gene Name | PIK3CB | Detection pipeline | . | ||||
| Sample Type | Nhek; K562; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_43805 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:138413627-138417937 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Kidney;Cortex;Liver_T11;Parietal;PA1;Liver_N12;Liver;Liver_T3;Liver_N10;Occipital;Cerebellum;Liver_T12;K562;Heart;H9;NHEK;Liver_N14;Temporal;H1;GM12878;Thyroid;Liver_T13;Stomach;Liver_T7;Liver_N11;Diencephalon;A549;Hs68;Liver_T17;Liver_N18;Liver_N21;Liver_N22;Liver_T18;Liver_N17;Liver_T19 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0067531 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:138413627-138417937:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000051382.4 | ||||
| Gene Name | PIK3CB | Detection pipeline | N/A | ||||
| Sample Type | Liver cell carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCCAGACCAGTACGTTCGAG | ||||||||
| Reverse Primer | TCACACAGTTGAGACAAGGGAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |