| Aliases | HSA_CIRCpedia_43952 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver;Liver_N19 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr3|146102754-146124229 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:n/a | ||||
| CircRNA type | circRNA | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | CIRCexplorer2 | ||||
| Sample Type | PDLSC osteogenis | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_002479 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | ERR688858 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000705 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR837797 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000026 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR922112 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_002410 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1643177 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_002922 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1643179 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_004340 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1643200 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000022 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1643525 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000843 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1706775 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000129 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1706776 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000890 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1706784 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000742 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1706787 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000647 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1706831 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000856 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1706839 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000969 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1706846 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006375 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1931812 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006016 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1931813 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006748 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1931814 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006709 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1931819 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_031863 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1363096 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_028651 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1363098 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_033150 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1363099 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_029850 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR1363100 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_008248 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131508 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_018462 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131525 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_010425 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131526 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_009162 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131527 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001356 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131528 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_018512 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131529 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006621 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131531 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000966 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131532 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_010113 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131533 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001149 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131534 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_016902 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131535 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001152 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131536 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_018497 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131537 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_016112 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131538 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001176 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131539 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_016670 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131540 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_027550 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131541 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_027462 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131542 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_026453 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131543 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_021653 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131544 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_023334 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2131546 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000759 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2654009 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001218 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2654022 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000720 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2654036 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_002293 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2924725 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_004016 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2924727 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005063 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR2924729 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_009115 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084933 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005940 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084935 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006877 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084940 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005196 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084947 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000957 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084948 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006461 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084950 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005481 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084951 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005092 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084952 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_008334 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084953 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_006801 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR3084954 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000831 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR954226 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000895 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR954227 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_000923 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR954233 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001749 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | . | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | . | ||||
| Sample Type | SRR954234 | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | test_circ_004006 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | 0 | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | FindCirc | ||||
| Sample Type | SS | ||||||||
| Method for Estimation | RNA-seq | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | 0 | ||||||||
| Reverse Primer | 0 | ||||||||
| Pubmed | |||||||
| Aliases | test_circ_004006 | Scientific name | Homo sapiens (hg38) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | 0 | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | FindCirc | ||||
| Sample Type | SS | ||||||||
| Method for Estimation | RNA-seq | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | 0 | ||||||||
| Reverse Primer | 0 | ||||||||
| Pubmed | |||||||
| Aliases | circRNA PLOD2 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:146102754-146124229:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000152952.11 | ||||
| Gene Name | PLOD2 | Detection pipeline | N/A | ||||
| Sample Type | PDLSC osteogenis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATCACTTTCTTTTGTTGCTACAGTT | ||||||||
| Reverse Primer | GGCAATTAATGGAAATGGACCC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |