| Aliases | hsa_circ_0067934 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:170013698-170015181:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000163558.8 | ||||
| Gene Name | PRKCI | Detection pipeline | . | ||||
| Sample Type | Nhek; K562; H1hesc; Bj; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_44371 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:170013698-170015181 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Cortex;Liver;A549;Liver_T14;Lung;Thyroid;Forebrain;Parietal;K562;Heart;PA1;Occipital;SH-SY5Y_D0_exp1;Stomach;Cerebellum;Diencephalon;HUVEC;SH-SY5Y_D2_exp1;H9;Temporal;Liver_T11;NHEK;H1;Liver_T15;BJ;Hs68;Liver_N21 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103510 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:170013698-170015181:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000163558.8 | ||||
| Gene Name | PRKCI | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_- circ_0067934 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:170013698-170015181:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000163558.8 | ||||
| Gene Name | PRKCI | Detection pipeline | N/A | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TAGCAGTTCCCCAATCCTTG | ||||||||
| Reverse Primer | CACAAATTCCCATCATTCCC | ||||||||
| Aliases | circPRKCI/hsa_circ_0067934 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:170013698-170015181:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000163558.8 | ||||
| Gene Name | PRKCI | Detection pipeline | N/A | ||||
| Sample Type | Lung adenocarcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATTCAGGGACACCCGTTCTT | ||||||||
| Reverse Primer | CTCTTCAGAACACTTGCAGCTT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |