| Aliases | hsa_circ_0068669 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:196612021-196613565:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000119231.6 | ||||
| Gene Name | SENP5 | Detection pipeline | . | ||||
| Sample Type | Nhek; K562; Huvec; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_45060 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:196612021-196613565 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T14;Liver;Liver_N15;GM12878;A549;Forebrain;Liver_T3;HeLa_S3;Cortex;K562;AG04450;Stomach;SH-SY5Y_D2_exp1;Liver_N14;Heart;Diencephalon;Liver_T10;H9;Liver_T12;Liver_N13;BJ;Liver_N7;NHEK;Liver_N12;Lung;PA1;Liver_T11;H1;Occipital;Hs68;Liver_T17;Liver_T20;Liver_T19;Liver_T18;Liver_N17;Liver_N21;Liver_N18;Liver_N19;Liver_N20;Liver_T22;Liver_N22 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103561 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:196612021-196613565:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000119231.6 | ||||
| Gene Name | SENP5 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0068669 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr3:196612021-196613565:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000119231.6 | ||||
| Gene Name | SENP5 | Detection pipeline | N/A | ||||
| Sample Type | Liver cell carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACAGTCAGAAAGCCTCTCCAG | ||||||||
| Reverse Primer | GCCTCCAAACCCAGTATTCCAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |