Aliases hsa_circ_0001313 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:56626997-56628056:+
CircRNA type . Gene ID ENSG00000163946.13
Gene Name FAM208A Detection pipeline .
Sample Type HEK293; cd_19; cd_34; neutr; Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_46448 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:56626997-56628056
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N13;Liver_N8;Liver_T15;PA1;Liver_N15;Liver_T10;Cortex;K562;Thyroid;Liver_T13;NHEK;HeLa_S3;Liver_N6;Liver_T11;Liver;SH-SY5Y_D0_exp2;Temporal;Liver_N12;SK_N_SH;Liver_T6;Kidney;Heart;SH-SY5Y_D4_exp1;Liver_N11;Forebrain;Liver_T8;Liver_T12;BJ;Occipital;Parietal;Liver_T14;SH-SY5Y_D4_exp2;Stomach;Liver_N7;HepG2;Liver_N10;SH-SY5Y_D0_exp1;A549;Liver_T7;Cerebellum;Diencephalon;Lung;H1;Liver_N3;Liver_N14;AG04450;SH-SY5Y_D2_exp1;Liver_T3;GM12878;Hs68;Liver_T20;Liver_N22;Liver_N18;Liver_N19;Liver_T17;Liver_N17;Liver_T21;Liver_T18;Liver_N20;Liver_N21;Liver_T22;Liver_T19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_006880 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:56626997-56628056:+
CircRNA type n/a Gene ID ENSG00000163946.13
Gene Name FAM208A Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr3:56626997-56628056 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:56626997-56628056:n/a
CircRNA type n/a Gene ID ENSG00000180376.12
Gene Name CCDC66 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_103393 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:56626997-56628056:+
CircRNA type exonic Gene ID ENSG00000163946.13
Gene Name FAM208A Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0001313/circCCDC66 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr3:56626997-56628056:+
CircRNA type N/A Gene ID ENSG00000163946.13
Gene Name FAM208A Detection pipeline N/A
Sample Type Colon cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TCTCTTGGACCCAGCTCAG
Reverse Primer TGAATCAAAGTGCATTGCCC
Pubmed 28249903
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size