| Aliases | hsa_circ_0009910 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:12049221-12052747:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000116688.12 | ||||
| Gene Name | MFN2 | Detection pipeline | . | ||||
| Sample Type | K562; Helas3; Bj; Ag04450 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_27546 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:12049221-12052747 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Occipital;Liver_N15;Liver_N12;Heart;Liver_T15;PA1;Forebrain;Liver;Diencephalon;Liver_N6;SH-SY5Y_D2_exp1;Cerebellum;SH-SY5Y_D4_exp1;Cortex;Temporal;HeLa_S3;Parietal;K562;Liver_T12;Liver_N3;Hs68;Liver_N21;Liver_T20 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_100053 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:12049221-12052747:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000116688.12 | ||||
| Gene Name | MFN2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0009910 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:12049221-12052747:n/a | ||||
| CircRNA type | n/a | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | n/a | ||||
| Sample Type | cervical carcinoma | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | Hsa_circ_0009910 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:12049221-12052747:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000116688.12 | ||||
| Gene Name | MFN2 | Detection pipeline | N/A | ||||
| Sample Type | Osteosarcoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TGAGAGGCATCAGTGAGGTG | ||||||||
| Reverse Primer | AAGTGCTTAAGTGGGGATGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |