Aliases hsa_circ_0006935 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:108603170-108622441:-
CircRNA type . Gene ID ENSG00000109475.16
Gene Name RPL34 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Hepg2; H1hesc; Gm12878; Bj; Ag04450; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_47098 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:108603170-108622441
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Diencephalon;SH-SY5Y_D4_exp1;AG04450;BJ;H1;SH-SY5Y_D0_exp2;Liver_T6;H9;HeLa_S3;Liver;Liver_T8;Liver_T12;Liver_T11;Liver_N13;SH-SY5Y_D2_exp1;Liver_T10;Parietal;Liver_T14;Liver_N3;Occipital;Stomach;Liver_N14;Liver_T13;HUVEC;Liver_N7;PA1;Kidney;Temporal;Liver_N11;Forebrain;GM12878;SH-SY5Y_D4_exp2;Liver_T3;A549;Cerebellum;SH-SY5Y_D0_exp1;SH-SY5Y_D8_exp2;Cortex;K562;HepG2;Hs68;Liver_T20;Liver_T21;Liver_T22;Liver_T17;Liver_N20;Liver_N22;Liver_N21;Liver_N19;Liver_N18;Liver_N17
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases chr4:108603170-108622441 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:108603170-108622441:n/a
CircRNA type n/a Gene ID ENSG00000138801.4
Gene Name PAPSS1 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_103716 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:108603170-108622441:-
CircRNA type exonic Gene ID ENSG00000109475.16
Gene Name RPL34 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circRNA_103716/hsa_circ_0006935 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:108603170-108622441:-
CircRNA type N/A Gene ID ENSG00000109475.16
Gene Name RPL34 Detection pipeline N/A
Sample Type Repeated implantation failure
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GTGGAACTTCTACAGGAACGGG
Reverse Primer TGGGCTTGGTAGGTGACATTG
Pubmed 29132137
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size