| Aliases | hsa_circ_0070933 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-128996148:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000151466.11 | ||||
| Gene Name | SCLT1 | Detection pipeline | . | ||||
| Sample Type | K562; Helas3; Gm12878; Bj; Ag04450 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_47402 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-128996148 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | BJ;A549;Liver_N14;Kidney;K562;Heart;Liver_N15;Liver;GM12878;H9;Occipital;NHEK;Stomach;Diencephalon;Liver_N7;Cerebellum;AG04450;Parietal;Liver_N13;Cortex;Thyroid;Hs68;Liver_T18;Liver_N22;Liver_N19;Liver_N17;Liver_N18;Liver_N21 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_004468 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-128996148:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000151466.11 | ||||
| Gene Name | SCLT1 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103736 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-128996148:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000151466.11 | ||||
| Gene Name | SCLT1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_103736 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-128996148 | ||||
| CircRNA type | N/A | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | N/A | ||||
| Sample Type | Cutaneous Squamous Cell Carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCTAGTGATTTCAGTGATATGGAG | ||||||||
| Reverse Primer | GTTGGATTTCTTTGTCTTGAGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |