| Aliases | hsa_circ_0070934 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-129012667:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000151466.11 | ||||
| Gene Name | SCLT1 | Detection pipeline | . | ||||
| Sample Type | K562; Helas3; H1hesc; Gm12878; Ag04450; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_47405 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-129012667 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H1;Liver;HeLa_S3;Liver_N7;Cortex;AG04450;Liver_N13;A549;Liver_N14;HepG2;Liver_T12;K562;Liver_N10;SH-SY5Y_D0_exp1;Liver_N11;Liver_T14;Parietal;Liver_N12;Liver_N15;Occipital;Liver_N17;Liver_N20;Liver_T19;Liver_T18;Liver_N22;Liver_N19;Liver_T22 | ||||||||
| Method for Estimation | poly(A)-;Ribo- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103737 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-129012667:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000151466.11 | ||||
| Gene Name | SCLT1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_103737 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:128995614-129012667 | ||||
| CircRNA type | N/A | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | N/A | ||||
| Sample Type | Cutaneous Squamous Cell Carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGTGTATCCTGTGGAAGAAGCAT | ||||||||
| Reverse Primer | TCACTAATTCACTTGGTGTTGGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |