| Aliases | hsa_circ_0001445 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464661-144465125:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000153147.5 | ||||
| Gene Name | SMARCA5 | Detection pipeline | . | ||||
| Sample Type | HEK293; cd_19; cd_34; neutr | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_47541 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464661-144465125 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N7;Liver_T14;SH-SY5Y_D4_exp2;Liver_N15;Liver_N6;Liver_N13;Liver_N11;Lung;Temporal;Stomach;Kidney;Forebrain;PA1;Liver_N12;Thyroid;K562;Liver_T13;Liver_T7;HepG2;SH-SY5Y_D8_exp2;Parietal;H9;SH-SY5Y_D0_exp2;A549;Liver_N14;Liver_N10;NHEK;Occipital;Liver_N3;Cortex;Liver_T8;Liver_T10;SK_N_SH;Liver_T6;Liver_N8;Liver;Cerebellum;Diencephalon;GM12878;SH-SY5Y_D2_exp1;Liver_T12;SH-SY5Y_D4_exp1;HUVEC;Liver_T15;BJ;Heart;Liver_T3;Liver_T11;SH-SY5Y_D0_exp1;AG04450;Hs68;Liver_N19;Liver_T18;Liver_T19;Liver_N20;Liver_N18;Liver_T17;Liver_T20;Liver_N22;Liver_N21;Liver_T21;Liver_T22;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_005300 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464661-144465125:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000153147.5 | ||||
| Gene Name | SMARCA5 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr4:144464661-144465125 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464661-144465125:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000153147.5 | ||||
| Gene Name | SMARCA5 | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA-chr19 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464661-144465125:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000153147.5 | ||||
| Gene Name | SMARCA5 | Detection pipeline | N/A | ||||
| Sample Type | Ebola virus disease | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGCATAGTCACAGTGCGGAC | ||||||||
| Reverse Primer | CAGCCTTTAACGGACTTGCA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |