| Aliases | chr4:144464662-144465125 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464662-144465125:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000153147.5 | ||||
| Gene Name | SMARCA5 | Detection pipeline | n/a | ||||
| Sample Type | colon cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsaCirc_011862 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464662-144465125:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000153147.5 | ||||
| Gene Name | SMARCA5 | Detection pipeline | Find_circ | ||||
| Sample Type | heart | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circSMARC1A | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:144464662-144465125:. | ||||
| CircRNA type | N/A | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | N/A | ||||
| Sample Type | Colon cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGCTTGTGGATCAGAATCTGAACA | ||||||||
| Reverse Primer | TCTCTATAGTCTTCTCCTTCGAAGT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |