| Aliases | hsa_circ_0071410 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:169812072-169837178:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000145439.7;ENSG00000129116.13 | ||||
| Gene Name | CBR4;PALLD | Detection pipeline | . | ||||
| Sample Type | Hsmm; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_47910 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:169812072-169837178 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Cortex;Liver_T12;Diencephalon;SH-SY5Y_D2_exp1;Liver_T14;SH-SY5Y_D4_exp1;AG04450;PA1;Stomach;Liver_N12;Heart;Liver_T3;Liver_T6;Temporal;Occipital;Parietal;A549;Liver_T8;Liver_T15;Liver_N13;Kidney;Liver_N6;Cerebellum;Hs68;Liver_T17;Liver_T18 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0071410 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:169812072-169837178:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000145439.7;ENSG00000129116.13 | ||||
| Gene Name | CBR4;PALLD | Detection pipeline | N/A | ||||
| Sample Type | Irradiated Hepatic Stellate Cell (HSC) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AGGAAAACTCTGCAGAATGGACTG | ||||||||
| Reverse Primer | CGTATGTTAACCTCGGCTGGC | ||||||||
| Aliases | hsa_circ_0071410 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:169812072-169837178:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000145439.7;ENSG00000129116.13 | ||||
| Gene Name | CBR4;PALLD | Detection pipeline | N/A | ||||
| Sample Type | Irradiated Hepatic Stellate Cell (HSC) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AGGAAAACTCTGCAGAATGGACTG | ||||||||
| Reverse Primer | CGTATGTTAACCTCGGCTGGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |