Aliases chr4:187627717-187630999 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:187627717-187630999:n/a
CircRNA type n/a Gene ID ENSG00000083857.9
Gene Name FAT1 Detection pipeline n/a
Sample Type colon cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsaCirc_012090 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:187627717-187630999:-
CircRNA type n/a Gene ID ENSG00000250590.5
Gene Name LINC02492 Detection pipeline Find_circ
Sample Type heart
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circFAT1 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:187627717-187630999:.
CircRNA type N/A Gene ID NA
Gene Name NA Detection pipeline N/A
Sample Type Colon cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACGCCAGAGCCATCTCTAAT
Reverse Primer GCAATGGGGAGACATTTGGC
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size