Aliases hsa_circ_0069399 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:36230203-36231267:-
CircRNA type . Gene ID ENSG00000047365.7
Gene Name ARAP2 Detection pipeline .
Sample Type Hepg2; Helas3; Gm12878; A549; Nhek
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_48455 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:36230203-36231267
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver;Cortex;HepG2;Parietal;Occipital;Lung;Liver_N15;Liver_T15;Liver_T14;Liver_N7;Liver_T6;Liver_T12;Liver_T10;Liver_N3;Liver_N14;Liver_N12;Diencephalon;Liver_T13;Liver_N6;Cerebellum;Liver_T7;Liver_T11;Liver_N10;Thyroid;Kidney;Liver_N13;Liver_N11;Liver_T8;Temporal;Liver_N8;GM12878;NHEK;HeLa_S3;Liver_T3;Liver_N21;Liver_T17;Liver_T22;Liver_N19;Liver_N20;Liver_T18;Liver_T20;Liver_N18;Liver_T19;Liver_T21;Liver_N17;Liver_N22
Method for Estimation Ribo-;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr4:36230203-36231267 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:36230203-36231267:n/a
CircRNA type n/a Gene ID ENSG00000047365.7
Gene Name ARAP2 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_103618 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:36230203-36231267:-
CircRNA type exonic Gene ID ENSG00000047365.7
Gene Name ARAP2 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0069399 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:36230203-36231267:n/a
CircRNA type n/a Gene ID ENSG00000047365.7
Gene Name ARAP2 Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0069399 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:36230203-36231267:-
CircRNA type N/A Gene ID ENSG00000047365.7
Gene Name ARAP2 Detection pipeline N/A
Sample Type Cervical carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACCAGAGATTCCAGGGTCAA
Reverse Primer TGGCTTTTCCTCTATCAATTGTG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size