| Aliases | hsa_circ_0069399 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:36230203-36231267:- | ||||
| CircRNA type | . | Gene ID | ENSG00000047365.7 | ||||
| Gene Name | ARAP2 | Detection pipeline | . | ||||
| Sample Type | Hepg2; Helas3; Gm12878; A549; Nhek | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_48455 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:36230203-36231267 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver;Cortex;HepG2;Parietal;Occipital;Lung;Liver_N15;Liver_T15;Liver_T14;Liver_N7;Liver_T6;Liver_T12;Liver_T10;Liver_N3;Liver_N14;Liver_N12;Diencephalon;Liver_T13;Liver_N6;Cerebellum;Liver_T7;Liver_T11;Liver_N10;Thyroid;Kidney;Liver_N13;Liver_N11;Liver_T8;Temporal;Liver_N8;GM12878;NHEK;HeLa_S3;Liver_T3;Liver_N21;Liver_T17;Liver_T22;Liver_N19;Liver_N20;Liver_T18;Liver_T20;Liver_N18;Liver_T19;Liver_T21;Liver_N17;Liver_N22 | ||||||||
| Method for Estimation | Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr4:36230203-36231267 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:36230203-36231267:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000047365.7 | ||||
| Gene Name | ARAP2 | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103618 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:36230203-36231267:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000047365.7 | ||||
| Gene Name | ARAP2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0069399 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:36230203-36231267:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000047365.7 | ||||
| Gene Name | ARAP2 | Detection pipeline | n/a | ||||
| Sample Type | cervical carcinoma | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0069399 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr4:36230203-36231267:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000047365.7 | ||||
| Gene Name | ARAP2 | Detection pipeline | N/A | ||||
| Sample Type | Cervical carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACCAGAGATTCCAGGGTCAA | ||||||||
| Reverse Primer | TGGCTTTTCCTCTATCAATTGTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |