Aliases hsa_circ_0007928 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:52729602-52752804:+
CircRNA type . Gene ID ENSG00000212490.1
Gene Name RF00568 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_48799 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:52729602-52752804
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type SH-SY5Y_D4_exp1;Liver_N14;Liver_N3;AG04450;SH-SY5Y_D0_exp1;Liver_N6;Liver_T12;H1;Liver_N7;BJ;Occipital;GM12878;Stomach;Liver;Liver_T15;Liver_N11;Forebrain;Lung;Liver_T10;SH-SY5Y_D8_exp2;K562;Cortex;Liver_T3;Liver_N12;Heart;Liver_T8;Liver_T14;H9;Thyroid;Parietal;Temporal;Liver_N10;Cerebellum;Liver_T7;Liver_N13;Liver_T13;Diencephalon;Liver_N15;Liver_T6;Liver_N8;NHEK;Hs68;Liver_T20;Liver_N20;Liver_N17;Liver_N19;Liver_T19;Liver_T18;Liver_T17;Liver_N21;Liver_T21;Liver_T22;Liver_N22;Liver_N18
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007436 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:52729602-52752804:+
CircRNA type n/a Gene ID ENSG00000212490.1
Gene Name RF00568 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_103637 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:52729602-52752804:+
CircRNA type exonic Gene ID ENSG00000212490.1
Gene Name RF00568 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0007928 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:52729602-52752804:n/a
CircRNA type n/a Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0007928 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:52729602-52752804:+
CircRNA type N/A Gene ID ENSG00000212490.1
Gene Name RF00568 Detection pipeline N/A
Sample Type Cervical carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GATGATGTTGTAGGCCCTGAA
Reverse Primer CGTCTTGGCCAATGTCTTCT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size