Aliases hsa_circ_0005912 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:54265896-54294350:+
CircRNA type . Gene ID ENSG00000134853.11
Gene Name PDGFRA Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_48826 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:54265896-54294350
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type SH-SY5Y_D0_exp2;Liver_T10;BJ;Thyroid;K562;Liver_T15;GM12878;Liver_T7;Forebrain;H9;Temporal;Liver_N7;Liver_N10;Occipital;Cortex;Liver_T6;A549;PA1;Liver;Liver_T14;NHEK;Cerebellum;HepG2;Parietal;Liver_N14;AG04450;Liver_N3;Liver_N13;SH-SY5Y_D0_exp1;Liver_N12;HeLa_S3;Liver_N15;Liver_T12;Diencephalon;Lung;H1;Liver_N6;Liver_T13;Liver_T8;Hs68;Liver_T21;Liver_N21;Liver_T20;Liver_N20;Liver_N19;Liver_N22;Liver_N17;Liver_N18;Liver_T17
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_103643 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:54265896-54294350:+
CircRNA type exonic Gene ID ENSG00000134853.11
Gene Name PDGFRA Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0005912 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:54265896-54294350:+
CircRNA type N/A Gene ID ENSG00000134853.11
Gene Name PDGFRA Detection pipeline N/A
Sample Type Basal cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AATTTTAGCAAACCACCTCCGT
Reverse Primer TCTGAGTTTCCAGTTCTTCCC
Pubmed 27097056
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size