Aliases hsa_circ_0000284 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33309057:+
CircRNA type . Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline .
Sample Type HEK293; cd_19; cd_34; neutr; Hs68_RNase; Hs68_control; K562; Huvec; Hsmm; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek; Nhlf; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_4134 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33309057
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N6;BJ;HUVEC;H1;Stomach;Temporal;SK_N_SH;SH-SY5Y_D4_exp1;Liver_T8;Thyroid;Liver_N7;Liver_N11;Liver_T7;PA1;Liver_N14;Liver_N15;Liver_T14;Occipital;SH-SY5Y_D2_exp1;Liver_T12;Cerebellum;Heart;GM12878;H9;Liver_N3;A549;Diencephalon;Liver_N10;Cortex;Parietal;Lung;SH-SY5Y_D8_exp2;NHEK;Liver_N8;SH-SY5Y_D0_exp2;Liver_T10;HepG2;Liver_T6;Kidney;Liver_T13;AG04450;Liver;K562;Liver_N12;Liver_T11;Forebrain;Liver_N13;SH-SY5Y_D0_exp1;HeLa_S3;Liver_T15;Liver_T3;SH-SY5Y_D4_exp2;Hs68;Liver_T21;Liver_T20;Liver_N22;Liver_N17;Liver_N18;Liver_T18;Liver_T17;Liver_N20;Liver_N19;Liver_T19;Liver_N21;Liver_T22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_000230 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33309057:+
CircRNA type n/a Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr11:33307958-33309057 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33309057:n/a
CircRNA type n/a Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_100782 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33309057:+
CircRNA type exonic Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circRNA_100782 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33309057:+
CircRNA type N/A Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline N/A
Sample Type Pre-Eclampsia (PE)
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GAAGGTGAAGGTCGGAGTC
Reverse Primer GAAGATGGTGATGGGATTTC
Pubmed 27606420
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size