Aliases hsa_circ_0008887 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33350179:+
CircRNA type . Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Huvec; Hepg2; Helas3; Gm12878; Bj; Ag04450; A549; Nhek; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_4135 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33350179
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T11;Occipital;Liver_N10;HepG2;A549;Liver;Parietal;Liver_N7;Liver_T14;Cerebellum;Diencephalon;Stomach;AG04450;Liver_N14;Cortex;Liver_T12;Liver_T7;Thyroid;BJ;Liver_N3;Liver_N12;HUVEC;Lung;HeLa_S3;K562;Liver_N11;Liver_T10;Temporal;Liver_T8;Hs68;Liver_N22;Liver_N17;Liver_N20;Liver_T20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_100783 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33350179:+
CircRNA type exonic Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circular RNA100783/hsa_circ_0008887 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:33307958-33350179:+
CircRNA type N/A Gene ID ENSG00000110422.7
Gene Name HIPK3 Detection pipeline N/A
Sample Type Immunosenescence
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCATTTTGTGAAGCCATAGAC
Reverse Primer CACATAGGTCCGTGGATAGTTT
Pubmed 26451160
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size