Aliases hsa_circ_0001417 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:73950965-73958017:-
CircRNA type . Gene ID ENSG00000132466.13
Gene Name ANKRD17 Detection pipeline .
Sample Type cd_19; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_49056 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:73950965-73958017
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T7;Liver_T12;SH-SY5Y_D2_exp1;Liver_N12;A549;Temporal;Liver_N10;Liver_N13;PA1;Lung;HUVEC;NHEK;Liver_T14;SH-SY5Y_D4_exp2;HeLa_S3;Liver_N11;Cerebellum;Liver_T13;SH-SY5Y_D8_exp2;Thyroid;Cortex;Liver_T10;SH-SY5Y_D0_exp1;Occipital;Liver_T11;Liver_N15;Stomach;Liver_T8;Liver_N3;BJ;SH-SY5Y_D4_exp1;Liver;Liver_N14;K562;Kidney;H9;Liver_T15;Forebrain;HepG2;H1;SH-SY5Y_D0_exp2;Liver_T3;Diencephalon;GM12878;SK_N_SH;AG04450;Liver_N6;Liver_N7;Parietal;Liver_T6;Liver_N8;Heart;Hs68;Liver_N22;Liver_T22;Liver_N20;Liver_T17;Liver_N18;Liver_N19;Liver_T19;Liver_N17;Liver_T18;Liver_T20;Liver_T21;Liver_N21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_103654 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:73950965-73958017:-
CircRNA type exonic Gene ID ENSG00000132466.13
Gene Name ANKRD17 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0001417 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr4:73950965-73958017:-
CircRNA type N/A Gene ID ENSG00000132466.13
Gene Name ANKRD17 Detection pipeline N/A
Sample Type Tuberculosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACCCGCAGCTGCTAACTTT
Reverse Primer TCAATTTCTTTGTCTGGATCCTTG
Pubmed 29057952
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size