Aliases hsa_circ_0005105 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:134022479-134023989:+
CircRNA type . Gene ID ENSG00000113615.8
Gene Name SEC24A Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_50238 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:134022479-134023989
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Kidney;Temporal;BJ;Heart;Thyroid;Occipital;HeLa_S3;Cortex;A549;Liver_T7;Stomach;Liver_T12;H1;HUVEC;Liver;Liver_T14;Liver_T15;H9;Cerebellum;K562;Diencephalon;NHEK;HepG2;Liver_N6;Liver_T8;Liver_N12;AG04450;Parietal;GM12878;PA1;Hs68;Liver_T17;Liver_N18;Liver_T19;Liver_N20;Liver_T21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_002478 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:134022479-134023989:+
CircRNA type n/a Gene ID ENSG00000113615.8
Gene Name SEC24A Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_103944 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:134022479-134023989:+
CircRNA type exonic Gene ID ENSG00000113615.8
Gene Name SEC24A Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0005105 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:134022479-134023989:+
CircRNA type N/A Gene ID ENSG00000113615.8
Gene Name SEC24A Detection pipeline N/A
Sample Type Osteoarthritis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGATATTGAAGTTACGACCACCTC
Reverse Primer GGAAGCAAATCCAGATTGTCTAAC
Pubmed 28276108
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size