| Aliases | hsa_circ_0005986 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:14057494-14068652:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000116731.18 | ||||
| Gene Name | PRDM2 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; Gm12878; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_27666 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:14057494-14068652 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T11;Cortex;Heart;K562;Parietal;Stomach;Liver_N11;Liver_T10;SH-SY5Y_D2_exp1;Occipital;Liver_N12;Liver_T15;Liver_T8;Lung;Cerebellum;Liver_T13;GM12878;Liver_N14;Temporal;Liver_N13;H9;BJ;Liver_N10;AG04450;NHEK;Liver_T7;Diencephalon;Liver_N8;A549;Liver;SH-SY5Y_D0_exp1;Liver_T14;Liver_T12;PA1;Hs68;Liver_T21;Liver_N19;Liver_T17;Liver_N20 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_002257 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:14057494-14068652:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000116731.18 | ||||
| Gene Name | PRDM2 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr1:14057494-14068652 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:14057494-14068652:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000116731.18 | ||||
| Gene Name | PRDM2 | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_100062 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:14057494-14068652:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000116731.18 | ||||
| Gene Name | PRDM2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0005986 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:14057494-14068652:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000116731.18 | ||||
| Gene Name | PRDM2 | Detection pipeline | N/A | ||||
| Sample Type | Liver cell carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GAAACTGGCTGCGATATGTG | ||||||||
| Reverse Primer | CACAGGCTCAGTAGTGTTCTTTAAA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |