Aliases hsa_circ_0074930 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:168233450-168250336:-
CircRNA type . Gene ID ENSG00000145934.16
Gene Name TENM2 Detection pipeline .
Sample Type Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_51093 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:168233450-168250336
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type SH-SY5Y_D0_exp2;A549;Thyroid
Method for Estimation Ribo-;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_104004 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:168233450-168250336:-
CircRNA type exonic Gene ID ENSG00000145934.16
Gene Name TENM2 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0074930 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:168233450-168250336:-
CircRNA type N/A Gene ID ENSG00000145934.16
Gene Name TENM2 Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGAAAGGGCTTGATGGAGATT
Reverse Primer TCGCAGTACAGGTGGTTGGA
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size