Aliases HRCR Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:43518035-43518979:+
CircRNA type N/A Gene ID NA
Gene Name NA Detection pipeline N/A
Sample Type Heart failure
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TCCGGTTTGTCCTTATATTC
Reverse Primer ACTGGAGAAAATTCGGAGT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
230 catgcagtgcccttgaagac tgaaactgggtcttctgcaag 55 47.619 59.475 58.424 158 387 20 21
167 agtgcccttgaagaccagaa gccctctctctagccccTA 50 63.158 58.86 59.145 163 329 20 19
262 gccttcatgtttgtctttgca gaattgaaactgggtcttctgc 42.857 45.455 57.904 57.834 130 391 21 22
221 agaccagaacagagtgtcaga tgggaattgaaactgggtcttc 47.619 45.455 58.049 58.504 174 394 21 22
231 gcccttgaagaccagaacag actgggaattgaaactgggtc 55 47.619 58.472 58.123 166 396 20 21
211 tcatgtttgtctttgcacctca tttattgaacactgagccctct 40.909 40.909 58.714 57.359 134 344 22 22
289 GCCCAGTGATGATGCAAAGG gcttcctggggtcaagtgat 55 55 59.541 59.67 32 320 20 20
130 AGTCCAACTCTCCAGCACAA aagtgatcctcgtgcctcag 50 55 58.868 59.466 178 307 20 20
175 AGACTTAGACACTGGCACCA gtcaagtgatcctcgtgcct 50 55 58.283 59.752 136 310 20 20
182 GACACTGGCACCAACTAGCT ctctgcttcctggggtcaag 55 60 59.965 60.036 143 324 20 20
188 ACTTAGACACTGGCACCAACT cctctgcttcctggggtc 47.619 66.667 59.231 59.006 138 325 21 18
166 GGGAATGAAACTTGGAGTCCA caacctctgcttcctggg 47.619 61.111 57.845 57.27 163 328 21 18
189 GCTGGGAATGAAACTTGGAGT ggtgcaatctcagctcact 47.619 52.632 58.481 57.452 160 348 21 19